Products from BPS Bioscience require a minimum order value above 400€
Application: Knock-out of BCMA in cells of interest.Generation of BMCA knock-out cell pools.Generation of a stable BCMA knock-out cell line following puromycin selection and single-cell selection.
Background: B-cell maturation antigen (BCMA), also known as CD269 or tumor necrosis factor receptor superfamily member 17 (TNFRSF17), is a cell surface receptor of the TNF receptor superfamily that recognizes B-cell activating factor (BAFF) and is involved in B cell proliferation and maturation. BCMA is preferentially expressed in mature B lymphocytes and the soluble form of BCMA can be found at higher levels in the serum of Multiple Myeloma (MM) patients. BCMA is a highly attractive target antigen for immunotherapy. BCMA, similarly to CD19, is restricted in expression to mature B cells, allowing the progenitorʹs population to be spared during treatment and to replenish the patientʹs B cell population. BMCA targeting therapies include bispecific antibodies, antibody-drug conjugates, and chimeric antigen receptor (CAR) T cells. To date, the FDA has approved two BCMA CAR-T therapies for the treatment of MM, that resulted in promising outcomes for patients. Further studies will allow a better understanding of the role of BCMA in cancer and fine tune cancer therapy tools.
Description: The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cellʹs genome to express both the Cas9 and sgRNAs. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus.Gene Target: Primer ID: sgRNA Sequence:TNFRSF17 (BCMA) TNFRSF17-1 CCTCTAACATGTCAGCGTTATNFRSF17 (BCMA) TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17 (BCMA) TNFRSF17-3 CGAGTACACGGTGGAAGAATTNFRSF17 (BCMA) TNFRSF17-4 TTCACTGAATTGGTCACACCTNFRSF17 (BCMA) TNFRSF17-5 GTGTTTTTAAACTCGTCCTTNote: BPS Bioscience also offers a non-integrating version of this product (BPS Bioscience #78894).
Formulation: The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS. Virus particles can be packaged in custom formulations by special request, for an additional fee.
Storage Stability: Lentiviruses are shipped with dry ice. For long-term storage, it is recommended to store the lentiviruses at -80°C. Avoid repeated freeze-thaw cycles. Titers can drop significantly with each freeze-thaw cycle.
Supplied As: Two vials (500 µl x 2) of lentivirus at a titer ≥1 x 107 TU/ml. The titer will vary with each lot; the exact value is provided with each shipment.
Warnings: Avoid freeze/thaw cycles
Biosafety Level: BSL-2